dna clean up kit (Zymo Research)
Zymo Research is a verified supplier 
Zymo Research manufactures this product 
97
Structured Review
Zymo Research
dna clean up kit
Dna Clean Up Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 97/100, based on 1716 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+clean+up+kit/DNA+Sequencing+Clean-Up/us12606813-1085-196-208
Average 97 stars, based on 1716 article reviews
Dna Clean Up Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 97/100, based on 1716 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+clean+up+kit/DNA+Sequencing+Clean-Up/us12606813-1085-196-208
Average 97 stars, based on 1716 article reviews
dna clean up kit - by Bioz Stars,
2026-10
97/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: Distribution of propiconazole-resistant <i>Geotrichum candidum</i> in peach orchards with or without cull fruit amendments Article Snippet: Resistance to propiconazole in Geotrichum candidum was reported previously in isolates collected from peaches after cold storage, but the origin of resistance was unclear.. If resistance had been generated and selected in the packinghouse with postharvest propiconazole drenches, we would expect to find resistance in the sour rot pathogen only in orchards that had received cull fruit returned to the orchard floor from the packinghouse.. In this study, 70G. candidum isolates were collected from seven orchards that had received cull fruit in the past from a packinghouse with documented resistance to propiconazole in G. candidum in stored fruit and six orchards that had never received cull fruit. Article Title: Compositions and methods for the encapsulation and scalable delivery of agrochemicals Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 minC_check_4_2 ATGTCAAACACGCCAATCGA 6 minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1× Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction 55 Cycles Conditions Temperature Time Steps (° C.) (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5° Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Article Title: Compositions and methods for enzyme immobilization Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 (SEQ ID NO:37) 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 (SEQ ID NO:38) 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 (SEQ ID NO:39) 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 (SEQ ID NO:40) minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 (SEQ ID NO:41) minC_check_4_2 ATGTCAAACACGCCAATCGA 6 (SEQ ID NO:42) minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 (SEQ ID NO:43) minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 (SEQ ID NO:44) TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1x Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Steps Temperature (° C.) Time (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5o Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Article Title: Compositions and methods for scalable production and delivery of biologicals Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Designa- Name Annealing Sequence tion 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 minC_check_4_2 ATGTCAAACACGCCAATCGA 6 minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 TABLE 7 Components for PCR reaction 50 uL Final Component Reaction Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2× Phusion Master Mix 25 uL 1× Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Temperature Time Steps (° C.) (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65.5° Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Tm Number o C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Purification:Article Title: Distribution of propiconazole-resistant <i>Geotrichum candidum</i> in peach orchards with or without cull fruit amendments Article Snippet: Resistance to propiconazole in Geotrichum candidum was reported previously in isolates collected from peaches after cold storage, but the origin of resistance was unclear.. If resistance had been generated and selected in the packinghouse with postharvest propiconazole drenches, we would expect to find resistance in the sour rot pathogen only in orchards that had received cull fruit returned to the orchard floor from the packinghouse.. In this study, 70G. candidum isolates were collected from seven orchards that had received cull fruit in the past from a packinghouse with documented resistance to propiconazole in G. candidum in stored fruit and six orchards that had never received cull fruit. Article Title: Pre-operative DNA methylation marks as predictors of weight loss outcomes after sleeve gastrectomy. Article Snippet: DNA concentration was quantified with a Qubit 3.0 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA) using Qubit dsDNA HS Assay Kit Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). .. Genomic DNA was bisulfite-treated using a Zymo EZ-96 DNA MethylationTM Kit (Zymo Research Corp, Irvine, CA, USA) and purified using a Article Title: Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT). Article Snippet: Tuberculosis (TB) screening in clinical diagnosis is challenging due to issues such as sputum dependence, timeconsuming procedures, and high costs.. In this study, we introduce a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing), an aptamer-based CRISPR/Cas12a assay designed for the rapid and sensitive detection of Mycobacterium tuberculosis (Mtb) antigens from peripheral blood.. Aptamer 3 (Ap3) and the aptamer-mediated probe (Aptamer-blocker 3–7) were selected through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Article Title: Pre-operative DNA methylation marks as predictors of weight loss outcomes after sleeve gastrectomy Article Snippet: DNA concentration was quantified with a Qubit 3.0 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA) using Qubit dsDNA HS Assay Kit Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). .. Genomic DNA was bisulfite-treated using a Zymo EZ-96 DNA MethylationTM Kit (Zymo Research Corp, Irvine, CA, USA) and purified using a Sequencing:Article Title: Distribution of propiconazole-resistant <i>Geotrichum candidum</i> in peach orchards with or without cull fruit amendments Article Snippet: Resistance to propiconazole in Geotrichum candidum was reported previously in isolates collected from peaches after cold storage, but the origin of resistance was unclear.. If resistance had been generated and selected in the packinghouse with postharvest propiconazole drenches, we would expect to find resistance in the sour rot pathogen only in orchards that had received cull fruit returned to the orchard floor from the packinghouse.. In this study, 70G. candidum isolates were collected from seven orchards that had received cull fruit in the past from a packinghouse with documented resistance to propiconazole in G. candidum in stored fruit and six orchards that had never received cull fruit. Article Title: Compositions and methods for the encapsulation and scalable delivery of agrochemicals Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 minC_check_4_2 ATGTCAAACACGCCAATCGA 6 minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1× Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction 55 Cycles Conditions Temperature Time Steps (° C.) (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5° Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Article Title: Compositions and methods for enzyme immobilization Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 (SEQ ID NO:37) 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 (SEQ ID NO:38) 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 (SEQ ID NO:39) 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 (SEQ ID NO:40) minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 (SEQ ID NO:41) minC_check_4_2 ATGTCAAACACGCCAATCGA 6 (SEQ ID NO:42) minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 (SEQ ID NO:43) minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 (SEQ ID NO:44) TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1x Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Steps Temperature (° C.) Time (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5o Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Article Title: Compositions and methods for scalable production and delivery of biologicals Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Designa- Name Annealing Sequence tion 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 minC_check_4_2 ATGTCAAACACGCCAATCGA 6 minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 TABLE 7 Components for PCR reaction 50 uL Final Component Reaction Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2× Phusion Master Mix 25 uL 1× Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Temperature Time Steps (° C.) (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65.5° Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Tm Number o C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Recombinase Polymerase Amplification:Article Title: Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT). Article Snippet: Tuberculosis (TB) screening in clinical diagnosis is challenging due to issues such as sputum dependence, timeconsuming procedures, and high costs.. In this study, we introduce a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing), an aptamer-based CRISPR/Cas12a assay designed for the rapid and sensitive detection of Mycobacterium tuberculosis (Mtb) antigens from peripheral blood.. Aptamer 3 (Ap3) and the aptamer-mediated probe (Aptamer-blocker 3–7) were selected through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Imaging:Article Title: Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT). Article Snippet: Tuberculosis (TB) screening in clinical diagnosis is challenging due to issues such as sputum dependence, timeconsuming procedures, and high costs.. In this study, we introduce a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing), an aptamer-based CRISPR/Cas12a assay designed for the rapid and sensitive detection of Mycobacterium tuberculosis (Mtb) antigens from peripheral blood.. Aptamer 3 (Ap3) and the aptamer-mediated probe (Aptamer-blocker 3–7) were selected through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Gene Knockout:Article Title: Compositions and methods for the encapsulation and scalable delivery of agrochemicals Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 minC_check_4_2 ATGTCAAACACGCCAATCGA 6 minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1× Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction 55 Cycles Conditions Temperature Time Steps (° C.) (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5° Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Article Title: Compositions and methods for enzyme immobilization Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 (SEQ ID NO:37) 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 (SEQ ID NO:38) 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 (SEQ ID NO:39) 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 (SEQ ID NO:40) minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 (SEQ ID NO:41) minC_check_4_2 ATGTCAAACACGCCAATCGA 6 (SEQ ID NO:42) minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 (SEQ ID NO:43) minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 (SEQ ID NO:44) TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1x Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Steps Temperature (° C.) Time (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5o Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Article Title: Compositions and methods for scalable production and delivery of biologicals Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Designa- Name Annealing Sequence tion 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 minC_check_4_2 ATGTCAAACACGCCAATCGA 6 minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 TABLE 7 Components for PCR reaction 50 uL Final Component Reaction Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2× Phusion Master Mix 25 uL 1× Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Temperature Time Steps (° C.) (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65.5° Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Tm Number o C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Concentration Assay:Article Title: Compositions and methods for the encapsulation and scalable delivery of agrochemicals Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 minC_check_4_2 ATGTCAAACACGCCAATCGA 6 minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1× Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction 55 Cycles Conditions Temperature Time Steps (° C.) (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5° Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Article Title: Compositions and methods for enzyme immobilization Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 (SEQ ID NO:37) 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 (SEQ ID NO:38) 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 (SEQ ID NO:39) 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 (SEQ ID NO:40) minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 (SEQ ID NO:41) minC_check_4_2 ATGTCAAACACGCCAATCGA 6 (SEQ ID NO:42) minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 (SEQ ID NO:43) minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 (SEQ ID NO:44) TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1x Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Steps Temperature (° C.) Time (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5o Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Article Title: Compositions and methods for scalable production and delivery of biologicals Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Designa- Name Annealing Sequence tion 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 minC_check_4_2 ATGTCAAACACGCCAATCGA 6 minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 TABLE 7 Components for PCR reaction 50 uL Final Component Reaction Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2× Phusion Master Mix 25 uL 1× Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Temperature Time Steps (° C.) (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65.5° Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Tm Number o C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Amplification:Article Title: Compositions and methods for the encapsulation and scalable delivery of agrochemicals Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 minC_check_4_2 ATGTCAAACACGCCAATCGA 6 minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1× Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction 55 Cycles Conditions Temperature Time Steps (° C.) (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5° Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Article Title: Compositions and methods for enzyme immobilization Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 (SEQ ID NO:37) 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 (SEQ ID NO:38) 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 (SEQ ID NO:39) 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 (SEQ ID NO:40) minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 (SEQ ID NO:41) minC_check_4_2 ATGTCAAACACGCCAATCGA 6 (SEQ ID NO:42) minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 (SEQ ID NO:43) minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 (SEQ ID NO:44) TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1x Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Steps Temperature (° C.) Time (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5o Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and Article Title: Compositions and methods for scalable production and delivery of biologicals Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Designa- Name Annealing Sequence tion 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 minC_check_4_2 ATGTCAAACACGCCAATCGA 6 minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 TABLE 7 Components for PCR reaction 50 uL Final Component Reaction Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2× Phusion Master Mix 25 uL 1× Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Temperature Time Steps (° C.) (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65.5° Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Tm Number o C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and DNA Purification:Article Title: A genome-wide methylation analysis of Chinese Han patients with chronic insomnia disorder. Article Snippet: and sleep opportunities.. The incidence of CID in adults is 6-10%, mostly in female and elderly individuals [23].. About 50% of the elderly complain of difficulty in falling asleep or maintaining sleep [31]. DNA Methylation Assay:Article Title: A genome-wide methylation analysis of Chinese Han patients with chronic insomnia disorder. Article Snippet: and sleep opportunities.. The incidence of CID in adults is 6-10%, mostly in female and elderly individuals [23].. About 50% of the elderly complain of difficulty in falling asleep or maintaining sleep [31]. |